Effect of VTCN1 on progression and metastasis of ovarian carcinoma in vitro and vivo
A B S T R A C T
Background and purposes: Through reducing immune response, VTCN1 could promote carcinoma indirectly. However, the direct effect of VTCN1 on carcinoma was not studied clearly, especially on ovarian carcinoma. In this paper, we verified the potential effect and mechanism of VTCN1 on ovarian carcinoma. Methods: The influence of high or low VTCN1 expression on the viability of ovarian cancer was detected by CKK-8 and annexin V-PI kit. The orthotopicxenograft tumor model was performed to evaluate the effect of VTCN1 on the promotion of tumor in vivo. Western blot was used to verify the signaling pathways predicted by bioinformatics analysis. Results: Low expression of VTCN1 could inhibit the viability and metastasis of ovarian carcinoma directly in vitro and vivo; Information analysis demonstrated that cell cycle and JAK2/STAT were involved in the regulation of VTCN1. The CDK2/4 and CDC25C expression and phosphorylation of JAK2/STAT had a direct relationship with the reduction of VTCN1. Conclusions: VTCN1 could affect the viability and metastasis of ovarian carcinoma by reducing the expression of CDK2/4 and CDC25C and phosphorylation of JAK2/STAT. It indicated that VTCN1 was a potential target for treating ovarian carcinoma.
1.Introduction
Ovarian carcinoma which is the fifth most common cause of death from carcinoma and the first most related to gynecologic carcinoma have a poor prognosis at advanced stage and the 5-year survival is less than 30% [1,2]. Worse, the first appearance of this cancer, over 75%, are at a late stage [3]. It enhances the difficulty to cure it. At present, standard therapy is surgery therapy followed by platin and taxan chemotherapy. Although it has good response rates, the disease over, 50% of the cases recur within the following 5 years [4,5]. Hence, it is imperative to find the predicted factors and targets for curing ovarian carcinoma.V-set domain containing T cell activation inhibitor 1(VTCN1), also known as B7-H4, B7X or B7S1, is a B7 family member and playscritical roles in regulating T-cell activation, cytokine secretion and the development of cytotoxicity [5–7]. In many prior papers, it proved to be a good predictable factor and target for many cancers. Quandt et al. reported that VTCN1 was associated with patients’ survival and antitumor immune response in human melanoma [8]. Zang et al. proved that the expression of B7-H4 was high and associated with disease spread and poor outcome in human prostate cancer. Krambeck et al. demonstrated that VTCN1 had a direct relationship with progression and survival of renal cell carcinoma and tumor vasculature [9]. These literatures implied that VTCN1 could influence carcinoma through regulating the immune response or adjusting the progression and survival of carcinoma. However, the mechanism of the direct effect on carcinoma is still not clear, especially in ovarian carcinoma, there is no report about it.In this study, we explored the biologic functions and underlying mechanisms of VTCN1 in ovarian carcinoma. The results from different experiments showed VTCN1 had a direct relationship wish proliferation, cell circle distribution and metastasis of ovarian cancer in vitro and vivo. Bioinformatics analysis demonstrated that JAK2/STAT3 and CDK2/CDK4/CDC25C signaling pathways linkedclosely with VTCN1 expression. The reports from western blot proved that low VTCN1 expression could reduce the signaling pathways activation of JAK2/STAT3 and CDK2/CDK4/CDC25C.
2.Materials and methods
Tumor tissue samples and normal tissue samples adjacent to tumor (within at least 5 cm of margin) were obtained from30 patients underwent definitive surgery in Shanghai Tongren Hospital. The independent ethics committee of Shanghai Tongren Hospital provided the ethical approval and patients (or their advisers) offered informed and written consent for the study under the guidelines of ethics committee.The gene expression data have been deposited in NCBIs Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series accession number GES12470.Agilent-012097 Human 1A Microarray for ovarian carcinoma and normal adjacent tissue were downloaded from the GES12470. To obtain more details about the biological pathways involved in ovarian carcinoma pathogenesis through VTCN1 pathway, a gene set enrichment analysis (GSEA) was performed. The KEGG gene sets biological process database (c2.KEGG.v4.0) from the Molecular Signatures Database (MsigDB, http://www. broad.mit.edu/gsea/msigdb/index.jsp) were carried out in the analysis of enrichment.The ovarian carcinoma cell lines HO-8910, SKOV3 and OVCAR3 were purchased from the Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China), and maintained in DMEM (10% fetalbovine serum, 1% penicillin and streptomycin) at 37 8C in a water-saturated carbon dioxide incubator (5%).
RNA interference sequence, GAAGGACCTTTCACCTTGTCT(1786), was designed and synthesised by JRDUN Biotechnology(Shan- ghai) co. Ltd. Under the guidelines of manufacturer, shRNA (or negative control) was transfected into cells through lentiviral vector (purchased from Addgene). Stable shRNA expression cells were harvested and processed for the follow analysis after transfection.96-well plates containing 1 × 105 cell in each well were incubated in the water-saturated carbon dioxide incubator (5%). Cell counting kit (Dojindo, Japan) was used to detect the cell proliferation at 12, 24 and 48 hours, respectively. The operation was carried out under the guidance of manual.and cycle of cells in a FACSCalibur cytometer (FACSCalibur, BD Biosciences), respectively.Boyden chamber containing 24-well transwell plates (Corning Inc.) with 8-mm pores membrane was used in the experiment of migration and invasion assays. The processes of migration andinvasion were similar as described in Dong’s paper [10]. The differences of migration and invasion were as follows: in invasion assay, the inserts were coated with Matrigel (BD Bioscience, Franklin Lakes, NJ, USA) and cells were incubated for 24 hours before detection; while in migration assay, the inserts were not coated and cells were incubated for 1 hour before detection.The details for qRT-PCR was as described in Sadun et al. [11] with some modifications: total RNA was prepared with Trizol Reagent (Invitrogen) and cDNA was synthesized with AMV reverse transcriptase (Fermentas, USA) according to the instruc- tions of manufacturer, respectively.
The primer pairs were shown in Table 1.Cells cultured in 6-well plate were harvested and washed with PBS twice before lysis. Cell lysis solution was centrifuged to get supernatant for electrophoresis. The process was similar with that described in Tulunay [12]. The primary antibodies against VTCN1 (Abcam), GAPDH (Fermentas), CDK2 (Abcam), CDK4 (Abcam), CDC25C (Abcam), p-JAK 2 and JAK 2 (CST), and p-STAT 3 and STAT 3(CST) were used in this study.Twelve 6-week-old male BALB/c nude mice (purchased from Charles River Japan Inc.) were divided into two groups. The method was described in Zhang et al. [13] with some modifications. OVCAR3 cells with stable VTCN1-shRNA or the respective empty vectors (both 4 × 106 cells) were injected into oxter. The size of tumors was determined at intervals of 3 or 4 days after the appearance of tumor about 2 weeks later. The tumors were harvested and weighed at 46 days after the injection.The results were showed as mean error. The statistical difference was analyzed by SPSS Version 16.0. The criterion of statistical significance was P < 0.05.Cells in 24-well plate were digested by trypsin and collected through centrifugation at 48 h after being seeded. The collected cells were resuspended by PBS and counted. Annexin V-Propidium Iodine(PI) staining kit (Becton Dickinson, for apotosis) or PI staining kit (for cycle, Beyotime) were used to detect the apoptosis. 3.Results and discussion Real-time PCR was performed to examine the expression of VTCN1 in ovarian carcinoma patients’ tissues. The detection results (Fig. 1A) from 30 ovarian cancer tissues and their adjacent normal tissues showed that VTCN1 expression have an obviously increase in tumor tissues compared with that in adjacent normal tissues(P < 0.01). According to the results (Fig. 1B) from Microarraydownloaded from the GES12470 for tumor tissue and normal adjacent tissue, we could know that VTCN1 mRNA expression in ovarian carcinoma tissue was significantly higher than that in normal tissue. Combining with the previous papers about the biological role of VTCN1 in other cancers containing pancreatic, renal cell and gastric carcinoma [14–16], we could have a conclusion that VTCN1 should have a direct relationship with ovarian cancer, but the details needed further research.In order to study the effect of VTCN1 on the ovarian carcinoma, the first step was to choose an ovarian cancer strain with high VTCN1 expression. As shown in Fig. 1C, the VTCN1 mRNA expression in OVCAR3 cells was obviously higher than the others. Moreover, the VTCN1 protein level detected by western blot was also the highest among these cell lines (Fig. 1D). Therefore, OVCAR3 cell was chosen as a research vehicle. The second step was to knockdown the VTCN1 expression in OVCAR3 cell to observe the variation of cell physiological with the reduction of VTCN1 expression. Through the analysis of the results of real-time PCR in Fig. 1A, we found that the transcription and expression of VTCN1 were reduced obviously through RNA interference by shRNA. Itdemonstrated that VTCN1 knockdown OVCAR3 cell line was established successfully and they could be used for further analysis.VTCN1 were reported that it could reduce immune response by inhibiting the activation of T-cell and cytokine secretion to protect tumor from being attacked by immune system. However, VTCN1 showed more complex relationships with the progression and metastasis of tumor in other researches. In this research, CKK-8 was performed to evaluate the regulation of proliferation of OVCAR3 cells by VTCN1. As shown in Fig. 2B, the significant difference of proliferation appeared at 12 h after seeding, and the difference was amplified as time goes on in 48 hours. It indicated that VTCN1 had a direct relationship with the regulation of the proliferation of OVCAR3 cells. As we all known, the variation of cell cycle is happened in almost all cancers, it is an avoidless process in the progression of carcinoma. The effect of VTCN1 on cell cycle of OVCAR3 cell line was shown in the Fig. 2C and D, the proportion of G0/G1phase in the cell cycle of OVCAR3 cell line with VTCN1 interference by shRNA was enhanced obviously compared with that in control or mock while the proportion of S and G1/M phases were reduced significantly. It implied that the expression reduction of VTCN1 in the OVCAR3 cell line blocked the transformation from G0/G1 phase to S phase. As we all know, there are complex links between cell cycle and cellapoptosis. Generally, the apoptosis of cellappearswiththe arrest of cell cycle. To confirm the variation of apoptosis induced by low VTCN1 expression, annexin V-PI stain kit was used to determine the apoptosis rate. As shown in Fig. 2E, the reduction of VTCN1 could promotetheapoptosis of OVCAR3 cells significantly. It indicated thatVTCN1 might be closely boundedwith the apoptosis of OVCAR3 cells through regulation of cell cycle.At the same time, we detected the influence of VTCN1 on the migration and invasion with transwell assays. As shown in Fig. 2F, the migration and invasion were inhibited obviously in the OVCAR3 cells with less VTCN1 expression. It proved that VTCN1 played an important role in the metastasis of ovarian carcinoma.To confirm the effect of VTCN1 on tumor in vivo, the orthotopicxenograft tumor model of BALB/c nude mice was established by injecting stable OCAVR cells with blank vector and with shRNA into the oxter. The size variation of tumor was showed in Fig. 3A and B, it demonstrated that the inhibition of VTCN1 by RNAi resulted in the significant difference in the progression of tumor. It indicated that the expression reduction of VTCN1 in vivo conduced to inhibition of tumor.GESA was performed to evaluate the VTCN1-associated path- ways, using date from the Gene Expression Omnibus database GSE12470. The coordinated differences in 188 predefined ‘‘KEGG pathways’’ gene sets was detected. According to the results in Fig. 4A and B, cell cycle relative pathway and JAK/STAT pathwaywere found to be significant association with VTCN1 expression in the GSE12470 dataset.According to previous reports, CDK2/CDK4/CDC25C played an important role in the regulation of cell cycle [17–19]. In many tumors, proliferation could be inhibited by the inhibitors of these cell cycle relative proteins [20–22]. And JAK2/STAT demonstrated the adjustment effect of proliferation, differentiation, apoptosis migration and immunity in cells according to previous researches [23–26]. Meanwhile, the results of bioinformatics analysis implied that JAK2/STAT and cell cycle signaling pathways were involved in the regulation caused by VTCN1. To confirm this evaluation, western blot was used to verify the signaling pathways affected by VTCN1. The results were shown in the Fig. 4C and D, the expression of CDK2/4 and CDC25C were reduced significantly and the phosphorylation of JAK2 and STAT were limited obviously under the shRNA interference of VTCN1 in OVCAR3 cell. It indicated that VTCN1 could affect proliferation and apoptosis of OVCAR3 cell through JAK2/STAT signaling pathway and regulation of cell cycle by adjusting expression of CDK2/4 and CDC25C. 4.Conclusions In this study, the direct effect and mechanism of VTCN1 on ovarian carcinoma was investigated. Initially, we found that VTCN1 involved in the signaling pathway CDK2/4 and CDC25C and JAK/STAT which has a tight connection with progression of cells through bioinformatics analysis. To confirm the effect of VTCN1 on OVCAR3 cells, we determined the variation of proliferation, cell cycle and apoptosis of OVCAR3 cells with VTCN1 RNA interference, through the analysis of results, we found that the reduction of VTCN1 could inhibit proliferation, block cell cycle at G0/G1 phase and promote apoptosis of OVCAR3 cells directly. Meanwhile, it was also proved that the low expression of VTCN1 could reduce the metasis and invasion in the assays of transwell. Through the detection of tumor size in the orthotopicxenograft tumor model of BALB/C nude mice, it proved that VTCN1 reduction had an inhibiting effect on cancer in vivo. At last, the results of bioinformatics analysis about the signaling pathway was verified by western CDK2-IN-4 blot, the results showed that the regulation effect of VTCN1 in ovarian carcinoma cells was tightly connected to the CDK2/4 and CDC25C and JAK2/STAT signaling pathway. From above all, we could confirm that VTCN1 could be an important target for curing ovarian cancer through this research.